Cswrky26
WebSep 18, 2024 · After solving Word Crossy Level 2625, we will continue in this topic with Word Crossy Level 2626, this game was developed by Word Find a famous one known … WebCsWRKY26 Csa002896 GU984025 645 1198 + + CsWRKY27 Csa002813 873 1123 + CsWRKY28 Csa016219 315 1475 + CsWRKY29 Csa016218 810 1328 - CsWRKY30 …
Cswrky26
Did you know?
WebCsWRKY26 Csa002896 GU984025 645 1198 + + CsWRKY27 Csa002813 873 1123 + CsWRKY28 Csa016219 315 1475 + CsWRKY29 Csa016218 810 1328 - CsWRKY30 Csa010443 840 2024 - CsWRKY31 Csa020355 1068 1737 + CsWRKY32 Csa014848 GU984026 975 2909 1 + + CsWRKY33 Csa009473 GU984027 1152 1559 1 + + … WebReceived: 30November2024;Accepted: 26January2024;Published: 19February2024;Corrected and Typeset: 28April2024 ©TheAuthor(s)2024 ...
WebJun 8, 2015 · According to the effects of SA and MeJA on the level of CsWRKY genes transcription, we predicted CsWRKY2, CsWRKY20, CsWRKY44 and CsWRKY52 may play roles not only in SA signaling pathway but also in JA signaling and CsWRKY26 and CsWRKY35 may play important roles only in SA signaling pathway. WebCsWRKY Carotenoids/apocarotenoids Biosynthetic pathway Jasmonates 1. Introduction Crocus sativus L., is a perennial herb of the Iridaceae. And its stigma, known as saffron, is a rare and precious traditional medicine known as “plant gold” ( Ding et al., 2024 ). Saffron is mainly used in medical, colorant, and spice ( Arzi and Hoshyar, 2024 ).
WebMay 28, 2024 · Camellia sinensis WRKY26 (CsWRKY26), a group I WRKY member, was characterized in this study. Tissue specificity of CsWRKY26 expression revealed that its … WebCsWRKY26 XP_010438720.1 XM_010440418.2 Csa11g017590 CsWRKY27 XP_010438721.1 XM_010440419.2 CsWRKY28 XP_019086219.1 XM_019230674.1 Csa10g016490 CsWRKY29 XP_010449897.1 XM_010451595.2 Csa02g058180 CsWRKY30 XP_010483009.1 XM_010484707.2 Csa18g027090 CsWRKY31 …
WebFeb 19, 2024 · However, to date, only five CsWRKYs have been identified: CsWRKY7 (group IId) , CsWRKY26 (group I) , CsWRKY2 (group I) , CsWRKY31 (group IIb), and …
WebCsWRKY26 forward: AATGTTGCTGTTTCGGTTAGT reverse:TGAATGCCTTCATAAGTTGTC CsWRKY27 forward: GGTTACTGTAAAGATTGGGTCT reverse:GAGATGTTGGGACCTGGAT CsWRKY28 forward: AAGGCTGTCAAACATAGCAACC reverse:GATGGATGATTGTGAATCCCTT … how is coconut oil refinedWebFeb 19, 2024 · However, less is known about L-theanine hydrolysis than about its biosynthesis, as the related genes remain largely unknown [].Recently, CsPDX2.1 was … how is cocktail sauce madeMoreover, CsWRKY26 transcripts were markedly induced by treatments with sodium chloride (NaCl), polyethylene glycol (PEG), drought and different hormones. Ectopic expression of CsWRKY26 conferred ABA insensitivity and tolerance to transgenic Arabidopsis plants subjected to PEG treatments. When exposed to 15% PEG, the expression levels of some ... highlander 2 the quickening trailerWebSep 26, 2024 · As shown in Fig. 5a, 8 CsWRKYs are presumed to interact with different CsVQ proteins, including CsWRKY3, CsWRKY26, CsWRKY41, CsWRKY48, CsWRKY51, CsWRKY52, CsWRKY55, CsWRKY64, CsWRKY67, among CsWRKY3, CsWRKY51 and CsWRKY67 belong to group IIc WRKY transcription factor and the others belong to the … highlander 30thWebMar 24, 2024 · Analyze the MSA and consult other resou Fig. 5 A CSWRKY51(c) CSWRKY3(lic) CsVQ21 CSWRKY67(lc) CsVQ22 CsVQ20 CsVQ23 CsVQ19 CsVQ14 CsVQ1 CsVQ18 CsVO2 CSWRKY55(0) CsVQ13 CsVQ15 CSWRKY4100) CSWRKY26(1) CSWRKY52(1) CsVQ3 CsVQ12 CSWRKY48(1) CsVQ1 how is coco quinn datingWebCsWRKY26 were redundant, and CsWRKY9, CsWRKY33, CsWRKY36, CsWRKY39, CsWRKY42, and CsWRKY46 did not contain an intact WRKY domain structure. The parameters that describe the CsWRKY proteins are listed in Table 1 Suppl., and they include the deduced protein length, relative molecular mass, and isoelectric point. The how is coconut water madeWebDownload scientific diagram Sequence alignment and phylogenetic tree analysis of CsWRKY26. (a) Multiple sequence alignment of amino acid sequences of CsWRKY26 with homologous WRKYs from... highlander 2 the quickening rated